It is about 700 bps.
Here is my interest seq:
Part: aaggcaacctatgtggatctccaagcacacgctcccccccacccccacccccgacctcaggttccactcccacccaaaatagagctgagttgtttactctggactgtttctttgagggaacctgatttacaagaaagctaatgcaggtttcactttcacttttagtttcgtttttaaatagtgtttgtttgtttttgtttttatcgacagcctctcagtagcagcccggttgtcttggagctctctctatagaccagagactcacctgccactggctcctgagtactggaattaaggcgtgtgtcaccgcaccgaagcctagtttcgttttttcttaaactgtgaatatcccaaagctgactctaaagtcatccgcaggaaatactatgagataaactcatgctcaaagggactgggtggcttcggtttcacagacagcggaggttggacaaggcttcc
I use the following command to get pdb file:
$AMBERHOME/bin/nab Part.nab
./a.out
then I try to convert it to mol2. But, I encounter error because of its number of ATOMs :-(
________________________________________
From: Mahdieh Hadi [mahdieh.hadi.bric.ku.dk]
Sent: Monday, February 29, 2016 3:31 PM
To: AMBER Mailing List
Subject: Re: [AMBER] Pdb file to Mol2
Yes, But, I have get the dna seq, convert it to pdb in Amber. Then I am going to get mol2 file from the pdb file in this process:
http://ambermd.org/tutorials/basic/tutorial4/create_prmtop.htm
to use it to get DNA.lib file,
so I could use lib files for TI as the below mentioned tutorial:
http://ambermd.org/tutorials/advanced/tutorial9/#setup_sander
So, is loading PDB files to Xleap helpful? Could I get .lib file from pdb file?
Thanks!
________________________________________
From: Daniel Roe [daniel.r.roe.gmail.com]
Sent: Friday, February 26, 2016 5:08 PM
To: AMBER Mailing List
Subject: Re: [AMBER] Pdb file to Mol2
Hi,
First, 1 week (!) for a project like this is simply not feasible. This
is the kind of project that you should expect to take more on the
order of at least a year, particularly if you have never done any kind
of MD simulation before.
Second, if your system is composed of standard nucleic and amino acids
then parameters for these already exist and there is no need to run
antechamber. This is well covered in introductory tutorials B0 and B1
(
http://ambermd.org/tutorials/#basic_tut) so you may want to review
those. You can load such a PDB directly into leap after you've loaded
the appropriate leaprc file. You may want to check the Amber 15 manual
Part III "System preparation" as well.
Good luck,
-Dan
On Fri, Feb 26, 2016 at 8:56 AM, Mahdieh Hadi <mahdieh.hadi.bric.ku.dk> wrote:
> It is a DNA seq, that I have derived by Nab command in pdb format.
> My goal is to find the mutations in the DNA sequence that could ruin the DNA-Protein interaction completely based on this article "Predicting the Effects of Basepair Mutations in DNA-Protein Complexes by Thermodynamic Integration" . My intended protein is a transcription factor that is derived from Protein data bank in PDB format.
> But I am just completely lost through my way!!!! :( :-/
> What is the best solution for this study!??
> I was supposed to end up this prediction in 1 week, But in this one week I have just gone through the amber tutorials and tried to resolve some basic errors :D with no result!
> By the way, I have amber tools 2015 installed.
> Bests
>
>
> ________________________________________
> From: Daniel Roe [daniel.r.roe.gmail.com]
> Sent: Friday, February 26, 2016 4:47 PM
> To: AMBER Mailing List
> Subject: Re: [AMBER] Pdb file to Mol2
>
> Hi,
>
> I don't know offhand what a TIW simulation is. Can you be more
> specific about your system (name, PDB ID, etc), and what the goal of
> your study is?
>
> -Dan
>
> On Fri, Feb 26, 2016 at 8:30 AM, Mahdieh Hadi <mahdieh.hadi.bric.ku.dk> wrote:
>> Hi, I am going to use it for TIW simulation. Is it eligible to use cpptraj command?
>>
>> ________________________________________
>> From: Daniel Roe [daniel.r.roe.gmail.com]
>> Sent: Friday, February 26, 2016 4:20 PM
>> To: AMBER Mailing List
>> Subject: Re: [AMBER] Pdb file to Mol2
>>
>> Hi,
>>
>> On Fri, Feb 26, 2016 at 5:03 AM, Mahdieh Hadi <mahdieh.hadi.bric.ku.dk> wrote:
>>> Hi,
>>> I use the following command for converting Part.pdb file to Part.Mol2,
>>>
>>> MHA:amber14 mha$ $AMBERHOME/bin/antechamber -i Part.pdb -fi pdb -o Part.mol2 -fo mol2 -c bcc -s 2
>>
>> What is your ultimate goal here? If the goal is just to convert from
>> PDB to Mol2 format you can just use cpptraj:
>>
>> cpptraj -p Part.pdb -y Part.pdb -x Part.mol2
>>
>> However, if you are trying to generate parameters for a molecule it
>> seems like Part.pdb is far too big and will need to be split into
>> subunits somehow. If you give some more details about what your
>> ultimate goal is we may be able to help further.
>>
>> -Dan
>>
>>>
>>>
>>> But, I received the following warnings and errors :(
>>>
>>>
>>> Warning: detected more than 10 Residue sequence numbers;
>>>
>>> this may be a large multiple residue PDB file;
>>>
>>> large multiple residue PDB files are not supported.
>>>
>>> Continuing, but problems may be encountered.
>>>
>>>
>>> The atom number exceeds the MAXATOM, reallocate memoryWarning: detected more than 10 Residue sequence numbers;
>>>
>>> this may be a large multiple residue PDB file;
>>>
>>> large multiple residue PDB files are not supported.
>>>
>>> Continuing, but problems may be encountered.
>>>
>>>
>>> Info: the bond number exceeds MAXBOND, reallocate memory automatically
>>>
>>> Running: /Users/amber14/bin/bondtype -j full -i ANTECHAMBER_BOND_TYPE.AC0 -o ANTECHAMBER_BOND_TYPE.AC -f ac
>>>
>>>
>>> Info: the atom number exceeds the MAXATOM, reallocate memory automatically
>>>
>>> ^CError: cannot run "/Users/amber14/bin/bondtype -j full -i ANTECHAMBER_BOND_TYPE.AC0 -o ANTECHAMBER_BOND_TYPE.AC -f ac" in judgebondtype() of antechamber.c properly, exit
>>>
>>>
>>>
>>>
>>> would you please give me some suggestions to resolve it, or alternatives to convert pdb file to Mol2?
>>>
>>> Bests
>>>
>>> _______________________________________________
>>> AMBER mailing list
>>> AMBER.ambermd.org
>>> http://lists.ambermd.org/mailman/listinfo/amber
>>
>>
>>
>> --
>> -------------------------
>> Daniel R. Roe, PhD
>> Department of Medicinal Chemistry
>> University of Utah
>> 30 South 2000 East, Room 307
>> Salt Lake City, UT 84112-5820
>> http://home.chpc.utah.edu/~cheatham/
>> (801) 587-9652
>> (801) 585-6208 (Fax)
>>
>> _______________________________________________
>> AMBER mailing list
>> AMBER.ambermd.org
>> http://lists.ambermd.org/mailman/listinfo/amber
>>
>> _______________________________________________
>> AMBER mailing list
>> AMBER.ambermd.org
>> http://lists.ambermd.org/mailman/listinfo/amber
>
>
>
> --
> -------------------------
> Daniel R. Roe, PhD
> Department of Medicinal Chemistry
> University of Utah
> 30 South 2000 East, Room 307
> Salt Lake City, UT 84112-5820
> http://home.chpc.utah.edu/~cheatham/
> (801) 587-9652
> (801) 585-6208 (Fax)
>
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
>
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
--
-------------------------
Daniel R. Roe, PhD
Department of Medicinal Chemistry
University of Utah
30 South 2000 East, Room 307
Salt Lake City, UT 84112-5820
http://home.chpc.utah.edu/~cheatham/
(801) 587-9652
(801) 585-6208 (Fax)
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
Received on Mon Feb 29 2016 - 07:30:04 PST