Hi,
Why do you want the file converted to mol2 format?
-Dan
On Mon, Feb 29, 2016 at 8:19 AM, Mahdieh Hadi <mahdieh.hadi.bric.ku.dk> wrote:
> It is about 700 bps.
> Here is my interest seq:
> Part: aaggcaacctatgtggatctccaagcacacgctcccccccacccccacccccgacctcaggttccactcccacccaaaatagagctgagttgtttactctggactgtttctttgagggaacctgatttacaagaaagctaatgcaggtttcactttcacttttagtttcgtttttaaatagtgtttgtttgtttttgtttttatcgacagcctctcagtagcagcccggttgtcttggagctctctctatagaccagagactcacctgccactggctcctgagtactggaattaaggcgtgtgtcaccgcaccgaagcctagtttcgttttttcttaaactgtgaatatcccaaagctgactctaaagtcatccgcaggaaatactatgagataaactcatgctcaaagggactgggtggcttcggtttcacagacagcggaggttggacaaggcttcc
> I use the following command to get pdb file:
> $AMBERHOME/bin/nab Part.nab
> ./a.out
> then I try to convert it to mol2. But, I encounter error because of its number of ATOMs :-(
>
> ________________________________________
> From: Mahdieh Hadi [mahdieh.hadi.bric.ku.dk]
> Sent: Monday, February 29, 2016 3:31 PM
> To: AMBER Mailing List
> Subject: Re: [AMBER] Pdb file to Mol2
>
> Yes, But, I have get the dna seq, convert it to pdb in Amber. Then I am going to get mol2 file from the pdb file in this process:
>
> http://ambermd.org/tutorials/basic/tutorial4/create_prmtop.htm
> to use it to get DNA.lib file,
> so I could use lib files for TI as the below mentioned tutorial:
> http://ambermd.org/tutorials/advanced/tutorial9/#setup_sander
> So, is loading PDB files to Xleap helpful? Could I get .lib file from pdb file?
> Thanks!
> ________________________________________
> From: Daniel Roe [daniel.r.roe.gmail.com]
> Sent: Friday, February 26, 2016 5:08 PM
> To: AMBER Mailing List
> Subject: Re: [AMBER] Pdb file to Mol2
>
> Hi,
>
> First, 1 week (!) for a project like this is simply not feasible. This
> is the kind of project that you should expect to take more on the
> order of at least a year, particularly if you have never done any kind
> of MD simulation before.
>
> Second, if your system is composed of standard nucleic and amino acids
> then parameters for these already exist and there is no need to run
> antechamber. This is well covered in introductory tutorials B0 and B1
> (http://ambermd.org/tutorials/#basic_tut) so you may want to review
> those. You can load such a PDB directly into leap after you've loaded
> the appropriate leaprc file. You may want to check the Amber 15 manual
> Part III "System preparation" as well.
>
> Good luck,
>
> -Dan
>
> On Fri, Feb 26, 2016 at 8:56 AM, Mahdieh Hadi <mahdieh.hadi.bric.ku.dk> wrote:
>> It is a DNA seq, that I have derived by Nab command in pdb format.
>> My goal is to find the mutations in the DNA sequence that could ruin the DNA-Protein interaction completely based on this article "Predicting the Effects of Basepair Mutations in DNA-Protein Complexes by Thermodynamic Integration" . My intended protein is a transcription factor that is derived from Protein data bank in PDB format.
>> But I am just completely lost through my way!!!! :( :-/
>> What is the best solution for this study!??
>> I was supposed to end up this prediction in 1 week, But in this one week I have just gone through the amber tutorials and tried to resolve some basic errors :D with no result!
>> By the way, I have amber tools 2015 installed.
>> Bests
>>
>>
>> ________________________________________
>> From: Daniel Roe [daniel.r.roe.gmail.com]
>> Sent: Friday, February 26, 2016 4:47 PM
>> To: AMBER Mailing List
>> Subject: Re: [AMBER] Pdb file to Mol2
>>
>> Hi,
>>
>> I don't know offhand what a TIW simulation is. Can you be more
>> specific about your system (name, PDB ID, etc), and what the goal of
>> your study is?
>>
>> -Dan
>>
>> On Fri, Feb 26, 2016 at 8:30 AM, Mahdieh Hadi <mahdieh.hadi.bric.ku.dk> wrote:
>>> Hi, I am going to use it for TIW simulation. Is it eligible to use cpptraj command?
>>>
>>> ________________________________________
>>> From: Daniel Roe [daniel.r.roe.gmail.com]
>>> Sent: Friday, February 26, 2016 4:20 PM
>>> To: AMBER Mailing List
>>> Subject: Re: [AMBER] Pdb file to Mol2
>>>
>>> Hi,
>>>
>>> On Fri, Feb 26, 2016 at 5:03 AM, Mahdieh Hadi <mahdieh.hadi.bric.ku.dk> wrote:
>>>> Hi,
>>>> I use the following command for converting Part.pdb file to Part.Mol2,
>>>>
>>>> MHA:amber14 mha$ $AMBERHOME/bin/antechamber -i Part.pdb -fi pdb -o Part.mol2 -fo mol2 -c bcc -s 2
>>>
>>> What is your ultimate goal here? If the goal is just to convert from
>>> PDB to Mol2 format you can just use cpptraj:
>>>
>>> cpptraj -p Part.pdb -y Part.pdb -x Part.mol2
>>>
>>> However, if you are trying to generate parameters for a molecule it
>>> seems like Part.pdb is far too big and will need to be split into
>>> subunits somehow. If you give some more details about what your
>>> ultimate goal is we may be able to help further.
>>>
>>> -Dan
>>>
>>>>
>>>>
>>>> But, I received the following warnings and errors :(
>>>>
>>>>
>>>> Warning: detected more than 10 Residue sequence numbers;
>>>>
>>>> this may be a large multiple residue PDB file;
>>>>
>>>> large multiple residue PDB files are not supported.
>>>>
>>>> Continuing, but problems may be encountered.
>>>>
>>>>
>>>> The atom number exceeds the MAXATOM, reallocate memoryWarning: detected more than 10 Residue sequence numbers;
>>>>
>>>> this may be a large multiple residue PDB file;
>>>>
>>>> large multiple residue PDB files are not supported.
>>>>
>>>> Continuing, but problems may be encountered.
>>>>
>>>>
>>>> Info: the bond number exceeds MAXBOND, reallocate memory automatically
>>>>
>>>> Running: /Users/amber14/bin/bondtype -j full -i ANTECHAMBER_BOND_TYPE.AC0 -o ANTECHAMBER_BOND_TYPE.AC -f ac
>>>>
>>>>
>>>> Info: the atom number exceeds the MAXATOM, reallocate memory automatically
>>>>
>>>> ^CError: cannot run "/Users/amber14/bin/bondtype -j full -i ANTECHAMBER_BOND_TYPE.AC0 -o ANTECHAMBER_BOND_TYPE.AC -f ac" in judgebondtype() of antechamber.c properly, exit
>>>>
>>>>
>>>>
>>>>
>>>> would you please give me some suggestions to resolve it, or alternatives to convert pdb file to Mol2?
>>>>
>>>> Bests
>>>>
>>>> _______________________________________________
>>>> AMBER mailing list
>>>> AMBER.ambermd.org
>>>> http://lists.ambermd.org/mailman/listinfo/amber
>>>
>>>
>>>
>>> --
>>> -------------------------
>>> Daniel R. Roe, PhD
>>> Department of Medicinal Chemistry
>>> University of Utah
>>> 30 South 2000 East, Room 307
>>> Salt Lake City, UT 84112-5820
>>> http://home.chpc.utah.edu/~cheatham/
>>> (801) 587-9652
>>> (801) 585-6208 (Fax)
>>>
>>> _______________________________________________
>>> AMBER mailing list
>>> AMBER.ambermd.org
>>> http://lists.ambermd.org/mailman/listinfo/amber
>>>
>>> _______________________________________________
>>> AMBER mailing list
>>> AMBER.ambermd.org
>>> http://lists.ambermd.org/mailman/listinfo/amber
>>
>>
>>
>> --
>> -------------------------
>> Daniel R. Roe, PhD
>> Department of Medicinal Chemistry
>> University of Utah
>> 30 South 2000 East, Room 307
>> Salt Lake City, UT 84112-5820
>> http://home.chpc.utah.edu/~cheatham/
>> (801) 587-9652
>> (801) 585-6208 (Fax)
>>
>> _______________________________________________
>> AMBER mailing list
>> AMBER.ambermd.org
>> http://lists.ambermd.org/mailman/listinfo/amber
>>
>> _______________________________________________
>> AMBER mailing list
>> AMBER.ambermd.org
>> http://lists.ambermd.org/mailman/listinfo/amber
>
>
>
> --
> -------------------------
> Daniel R. Roe, PhD
> Department of Medicinal Chemistry
> University of Utah
> 30 South 2000 East, Room 307
> Salt Lake City, UT 84112-5820
> http://home.chpc.utah.edu/~cheatham/
> (801) 587-9652
> (801) 585-6208 (Fax)
>
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
>
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
>
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
--
-------------------------
Daniel R. Roe, PhD
Department of Medicinal Chemistry
University of Utah
30 South 2000 East, Room 307
Salt Lake City, UT 84112-5820
http://home.chpc.utah.edu/~cheatham/
(801) 587-9652
(801) 585-6208 (Fax)
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
Received on Mon Feb 29 2016 - 08:00:05 PST
