Hi Niel, David,
Thanks for your replies.
True, I don't actually know if the 5'-phosphate is vital for what I am
trying to do, so for now I will run the simulation keeping the
5'-hydroxyl as is. If that works, at a later stage I can try again with
a 5'-phospate using either RED or, as David suggested, by using OHE as
the 5' nucleotide.
Thanks again,
-Michiel.
On 9/1/12 0:47 , Niel Henriksen wrote:
> Michiel,
>
> The standard nucleic acid residues in AMBER were not
> parameterized to include a 5'-phosphate. You would need
> to create a new residue for this (mol2 and frcmod files for
> charges and parameter info respectively).
>
> You could fudge this by hand (probably a bad idea) or you
> could use the established procedure often done with RED:
>
> http://q4md-forcefieldtools.org/REDS/
>
> Most RNA simulations in the literature do not include the
> 5'-phosphate. Are you sure it's vital for your results?
>
> --Niel
>
> ________________________________________
> From: Michiel de Hoon [mdehoon.gsc.riken.jp]
> Sent: Friday, August 31, 2012 8:30 AM
> To: amber.ambermd.org
> Subject: [AMBER] newbie question: simulating miRNA
>
> Dear all,
>
> I am trying to simulate the dynamics of a mature microRNA of 22
> nucleotides, and I am running into a problem creating the initial structure.
>
> The sequence I want to simulate is "uagcuuaucagacugauguuga".
> To create a PDB file with this sequence, I use this .nab file:
>
> molecule m;
>
> m = fd_helix("arna", "auagcuuaucagacugauguuga", "rna");
> putpdb( "mirna.pdb", m, "-wwpdb");
>
> I run nab on it, and I run the resulting executable. This gives me the
> mirna.pdb file.
> Since this PDB file contains a double helix of RNA and I am interested
> in only a single strand, I edit the PDB file to remove the second strand.
>
> The sequence I give to fd_helix has one additional nucleotide "a" at the
> 5' side. This is because I noticed that fd_helix creates an RNA with a
> 5' hydroxyl group instead of a 5' phosphate group. So I added this dummy
> nucleotide, I remove all its atoms except its final oxygen from the PDB
> file, and associate the last oxygen with the subsequent "u" nucleotide.
> My PDB file then looks as follows:
>
> ATOM 1 OP3 U 1 7.297 -6.145 5.250 1.00
> 0.00 O
> ATOM 2 P U 1 6.882 -5.338 6.560 1.00
> 0.00 P
> ATOM 3 OP1 U 1 7.505 -5.970 7.750 1.00
> 0.00 O
> ATOM 4 OP2 U 1 5.404 -5.201 6.610 1.00
> 0.00 O
> ATOM 5 O5' U 1 7.538 -3.907 6.290 1.00
> 0.00 O
> ATOM 6 C5' U 1 8.968 -3.825 6.160 1.00
> 0.00 C
> ATOM 7 H5' U 1 9.304 -4.443 5.327 1.00
> 0.00 H
> ATOM 8 H5'' U 1 9.430 -4.176 7.083 1.00
> 0.00 H
> ATOM 9 C4' U 1 9.384 -2.375 5.910 1.00
> 0.00 C
> ATOM 10 H4' U 1 10.470 -2.299 5.860 1.00
> 0.00 H
> ...
> ATOM 698 C2' A 22 7.329 -4.907 64.990 1.00
> 0.00 C
> ATOM 699 H2' A 22 7.159 -4.004 65.576 1.00
> 0.00 H
> ATOM 700 O2' A 22 8.718 -5.197 64.960 1.00
> 0.00 O
> ATOM 701 HO2' A 22 9.154 -4.443 64.556 1.00
> 0.00 H
> ATOM 702 O3' A 22 7.233 -6.221 67.070 1.00
> 0.00 O
> ATOM 703 HO3' A 22 7.285 -5.486 67.686 1.00
> 0.00 H
> TER
>
>
> Then I start xleap:
>
> xleap -s -f $AMBERHOME/dat/leap/cmd/leaprc.ff99SB
>
> I don't know if ff99SB is the appropriate force field to use to simulate
> RNA, but that is what I used.
>
> Inside xleap I then do:
>
> > rna1 = loadpdb "mirna.pdb"
> Loading PDB file: ./mirna.pdb
> Created a new atom named: OP3 within residue: .R<RU5 1>
> Created a new atom named: P within residue: .R<RU5 1>
> Created a new atom named: OP1 within residue: .R<RU5 1>
> Created a new atom named: OP2 within residue: .R<RU5 1>
> total atoms in file: 703
> Leap added 1 missing atom according to residue templates:
> 1 H / lone pairs
> The file contained 4 atoms not in residue templates
>
> Next I add sodium ions for neutralization:
> > addions rna1 Na+ 0
> 21 Na+ ions required to neutralize
> Adding 21 counter ions to "rna1" using 1A grid
> ...
>
> So this is my problem: Only 21 counter ions are added, while the
> microRNA contains 22 nucleotides. The output from loadpdb suggests that
> the 5' phospate group is not being recognized, which may be the reason
> why xleap only adds 21 sodium ions.
> What is then the right way to create an RNA sequence with a phosphate on
> its 5' side and a hydroxyl group on its 3' side?
>
> Many thanks in advance,
> -Michiel
>
>
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
>
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
Received on Fri Aug 31 2012 - 20:30:02 PDT
