Dear prof. Case,
thank you very much for your help !
Best,
Marek
Dne Mon, 11 May 2009 13:34:16 +0200 David A. Case
<case.biomaps.rutgers.edu> napsal/-a:
> On Sun, May 10, 2009, Marek Malý wrote:
>>
>> I would like to create single strand DNA "CTCTCGCACCCATCTCTCTCCTTCT"
>> (GEM91) using NAB program.
>
> There is, presumably, no single correct struture for single-stranded
> DNA. It
> is reasonable to create a duplex, then remove one of the strands, but
> this is
> only a rough approximation.
>
> The fd_helix() routine in NAB is appropriate, or you can create a
> variety of
> DNA helices at http://w3dna.rutgers.edu/index.php/rebuild.
>
>> m = link_na("1", seq, "dna.amber94.rlb", "dna", "35");
>
> This creates a arbitrary structure; the torsion angles on the backbone
> are
> unlikely to be reasonable. It is intended for constructing the covalent
> structure only.
>
>> m = bdna( "ctctcgcacccatctctctccttct" );
>
> This should be fine, after removing the second strand.
>
>> putpdb( "GEM91ds.pdb", m );
>
>> In the case #1 there is used CYT, THY, GUA ... and in the case #2
>> DC,DT,DG ...
>
> The latter is consistent with the current (version 3) naming scheme in
> the
> PDB.
>
> ...dac
>
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
>
> __________ Informace od NOD32 4051 (20090504) __________
>
> Tato zprava byla proverena antivirovym systemem NOD32.
> http://www.nod32.cz
>
>
--
Tato zpráva byla vytvořena převratným poštovním klientem Opery:
http://www.opera.com/mail/
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
Received on Wed May 20 2009 - 15:34:29 PDT
