On Sun, May 10, 2009, Marek Malư wrote:
>
> I would like to create single strand DNA "CTCTCGCACCCATCTCTCTCCTTCT"
> (GEM91) using NAB program.
There is, presumably, no single correct struture for single-stranded DNA. It
is reasonable to create a duplex, then remove one of the strands, but this is
only a rough approximation.
The fd_helix() routine in NAB is appropriate, or you can create a variety of
DNA helices at
http://w3dna.rutgers.edu/index.php/rebuild.
> m = link_na("1", seq, "dna.amber94.rlb", "dna", "35");
This creates a arbitrary structure; the torsion angles on the backbone are
unlikely to be reasonable. It is intended for constructing the covalent
structure only.
> m = bdna( "ctctcgcacccatctctctccttct" );
This should be fine, after removing the second strand.
> putpdb( "GEM91ds.pdb", m );
> In the case #1 there is used CYT, THY, GUA ... and in the case #2
> DC,DT,DG ...
The latter is consistent with the current (version 3) naming scheme in the
PDB.
...dac
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
Received on Wed May 20 2009 - 15:34:11 PDT
