Re: [AMBER] problem with nab

From: Jason Swails <jason.swails.gmail.com>
Date: Wed, 11 Feb 2015 09:06:49 -0500

On Wed, Feb 11, 2015 at 8:53 AM, Urszula Uciechowska <
urszula.uciechowska.biotech.ug.edu.pl> wrote:

>
> Dear amber users,
>
> I would like to generate ssDNA. I have already tried to run nab:
>
> molecule m;
> string seq;
> seq = "attggacagaaaattggacgaaaatttggttataaatatttggaacaaaaatt";
> m =link_na("1",seq,"dna");
> putpdb("ssDNA-1.pdb", m);
>
> but I am getting an error:
>
> Catastrophic error: could not set locale "" to allow processing of
> multibyte characters
>

​This sounds like a character encoding issue. NAB was written in the days
when ASCII reigned supreme, so I doubt that it has any kind of unicode-like
support. This seems to suggest that your code *somewhere* has a non-ASCII
character somewhere in it.

Common culprits are curly quotation marks (they should be straight
up-and-down) and a hyphen (-) being automatically turned into an m- or
n-dash. This could happen if you copy-and-paste your code from some kind
of "sophisticated" editor (like common word processors or perhaps some PDF
files) and pasted it into a text file.

If you send me your file, I will try to take a look.

HTH,
Jason
​
-- 
Jason M. Swails
BioMaPS,
Rutgers University
Postdoctoral Researcher
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
Received on Wed Feb 11 2015 - 06:30:02 PST
Custom Search