I think there’s clearly something wrong with your setup.
Have you made sure that you don’t have steric clashes in your structure?
Do you have any ions? It’s also recommended that you have counterions but also use a buffer of ions (KCl or NaCl).
Do you need any Mg2+?
As Jana said, it’s recommended you use OPC.
I have run siRNA simulations just fine. While I could argue about a gHBfix vs. HRfix vs. Love et al. approach to the RNA, all of them would preserve your RNA base pairing.
Maria
> On May 14, 2025, at 3:46 PM, Mlynsky Vojtech via AMBER <amber.ambermd.org> wrote:
>
> Hi Jana,
>
> .. I would suggest to use hydrogen-bond fix (HBfix) to support H-bonding between RNA base pairs.
>
> You can apply either general HBfix (gHBfix) or ’structure-specific’ HBfix (sHBfix), where you modify just specific interactions (e.g., interactions between terminal residues). gHBfix restrains can be prepared by our gHBfix code available in the Supporting Information of Frohlking et al., JCTC 2022 paper (https://pubs.acs.org/doi/abs/10.1021/acs.jctc.2c00200). The output can be printed as AMBER restrains or as PLUMED input file (in case you want use Gromacs code; see help notes). In case of sHBfix (you want to modify just interaction between terminal base pairs), you can filter those interactions or prepare the input manually.
>
> Good luck,
> Vojtech.
>
>
> On 14. 5. 2025, at 1:16 PM, Abhisek Jana via AMBER <amber.ambermd.org> wrote:
>
>
>
> Hello,
>
> I am currently performing molecular dynamics simulations of a siRNA-protein complex using the OL3-ff19SB force field combination with the TIP3P water model. The 21-mer siRNA sequence used in the study is as follows:
>
> _AAUAUCUCGUUCUUGUGACAA_
>
> _UUAUAGAGCAAGAACACUGUU_
>
> While analysing the trajectory from the production run, I observed that the Watson-Crick base pairing remains stable only up to the 17th base pair. Beyond this point (i.e., after the 17-mer), the base pairing is not maintained consistently, and the hydrogen bonds between the corresponding bases are frequently disrupted throughout the simulation. I have attached the input files from all stages of the MD simulation for your reference. I would appreciate any insights or suggestions you might have regarding this instability issue. Thank you.
>
> Step1:Minimize water and ions
> &cntrl
> imin=1, maxcyc=20000, ncyc=15000,
> cut=10.0,
> ntb=1,
> ntr=1,
> restraint_wt=10.0,
> restraintmask='!:WAT & !:Na+ & !:Cl-',
> /
>
> Step2:Unrestrained minimization
> imin=1, maxcyc=30000, ncyc=25000,
> cut=10.0,
> ntb=1,
> ntr=0,
> /
>
> Step-3:Relax water
> LET WATER MOVE
> &cntrl
> timlim = 999999., nmropt = 0, imin = 0,
> ntx = 1, irest = 0, ntrx = 1, ntxo = 1,
> ntpr = 500, ntwx = 500, ntwv = 0, ntwe = 0,
> ntwr = 500,
> ntf = 2, ntb = 2,
> cut = 10.0, nsnb = 20,
> nstlim = 50000, nscm = 2500, iwrap = 1,
> t = 0.0, dt = 0.002,
> temp0 = 300.0, tempi = 200.0, tautp=0.5,
> ntt = 1,
> ntp =1 , taup = 1.0,
> ntc = 2, tol = 0.00001,
> ibelly=0, ntr=1,
> restraintmask=':1-873' , restraint_wt=10.0,
> &end
> /
>
> Step-4:heat NPT 0.5 ns
> Heating System
> &cntrl
> imin=0, nmropt=1,
> ntx=1, irest=0,
> ntpr=500, ntwr=500, ntwx=500, iwrap=1,
> ntf=2, ntb=1, cut=10.0, nsnb=20,
> igb=0,
> ibelly=0, ntr=1,
> nstlim=250000, nscm=500, dt=0.002,
> ntt=1, temp0=300.0, tempi=0.0, tautp=0.5
> ntc=2,restraintmask=':1-873',
> restraint_wt=100,
> &end
>
> &wt type='REST', istep1=0, istep2=0, value1=1.0, value2=1.0, &end
> &wt type='TEMP0', istep1=0, istep2=250000, value1=0.0, value2=300, &end
> &wt type='END' &end
> /
>
> Step-5:Density Equilibration
> &cntrl
> imin=0, nstlim=250000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=2, ntp=1, taup=1.0,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=10000, ntwx=10000, ntwr=10000,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1, restraintmask=':1-873', restraint_wt=20.0,
> ioutfm=1, barostat=2,
> /
>
> Step-6:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1,
> restraintmask="(:1-838 & @CA,C,N,O) | (:839) | (:840 & @P2,O9,O10,O12,O4,O2,C5,C3,C1) | (:841-873 & @P,OP1,OP2,O3',O5',C3',C4',C5')",
> restraint_wt=10.0,
> ioutfm=1,
> /
>
> Step-7:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1,
> restraintmask="(:1-838 & @CA,C,N,O) | (:839) | (:840 & @P2,O9,O10,O12,O4,O2,C5,C3,C1) | (:841-873 & @P,OP1,OP2,O3',O5',C3',C4',C5')",
> restraint_wt=5.0,
> ioutfm=1,
> /
>
> Step-8:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1,
> restraintmask="(:1-838 & .CA,C,N,O) | (:839) | (:840 & @P2,O9,O10,O12,O4,O2,C5,C3,C1) | (:841-873 & @P,OP1,OP2,O3',O5',C3',C4',C5')",
> restraint_wt=1.0,
> ioutfm=1,
> /
>
> Step-9:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1,
> restraintmask="(:1-838 & .CA,C,N,O) | (:839) | (:840 & @P2,O9,O10,O12,O4,O2,C5,C3,C1) | (:841-873 & @P,OP1,OP2,O3',O5',C3',C4',C5')",
> restraint_wt=0.25,
> ioutfm=1,
> /
>
> Step-10:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=0,
> ioutfm=1,
> /
>
> Step-11:good energy conservation, 2fs.
> &cntrl
> ntx=5, irest=1,
> ntc=2, ntf=2, tol=0.000001,
> nstlim=250000000,
> ntpr=1000, ntwx=1000,
> ntwr=10000,
> dt=0.002, cut=8.0,
> ntt=0, ntb=1, ntp=0, ntr=0,
> ioutfm=1,
> /
> &ewald
> dsum_tol=0.000001,
> /
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
>
> ======================================
> Vojtech Mlynsky
> Structure and Dynamics of Nucleic Acids
> Institute of Biophysics of the Czech Academy of Sciences
> Kralovopolska 135, 612 00, Brno, Czech Republic
> ======================================
>
>
>
>
>
>
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
Received on Wed May 14 2025 - 13:30:02 PDT
