I suggest starting out by looking into the force field choices. TIP3P is an
old model, with many papers showing the weaknesses. Furthermore, ff19sb
specifically should be used with the much newer and more accurate OPC.
There are also papers showing that OPC gives better RNA results.
Your input files also have many outdated choices. There are more modern
protocols in the tutorials at the ambermd.org site.
On Wed, May 14, 2025, 7:17 AM Abhisek Jana via AMBER <amber.ambermd.org>
wrote:
>
>
> Hello,
>
> I am currently performing molecular dynamics simulations of a
> siRNA-protein complex using the OL3-ff19SB force field combination with
> the TIP3P water model. The 21-mer siRNA sequence used in the study is as
> follows:
>
> _AAUAUCUCGUUCUUGUGACAA_
>
> _UUAUAGAGCAAGAACACUGUU_
>
> While analysing the trajectory from the production run, I observed that
> the Watson-Crick base pairing remains stable only up to the 17th base
> pair. Beyond this point (i.e., after the 17-mer), the base pairing is
> not maintained consistently, and the hydrogen bonds between the
> corresponding bases are frequently disrupted throughout the simulation.
> I have attached the input files from all stages of the MD simulation for
> your reference. I would appreciate any insights or suggestions you might
> have regarding this instability issue. Thank you.
>
> Step1:Minimize water and ions
> &cntrl
> imin=1, maxcyc=20000, ncyc=15000,
> cut=10.0,
> ntb=1,
> ntr=1,
> restraint_wt=10.0,
> restraintmask='!:WAT & !:Na+ & !:Cl-',
> /
>
> Step2:Unrestrained minimization
> imin=1, maxcyc=30000, ncyc=25000,
> cut=10.0,
> ntb=1,
> ntr=0,
> /
>
> Step-3:Relax water
> LET WATER MOVE
> &cntrl
> timlim = 999999., nmropt = 0, imin = 0,
> ntx = 1, irest = 0, ntrx = 1, ntxo = 1,
> ntpr = 500, ntwx = 500, ntwv = 0, ntwe = 0,
> ntwr = 500,
> ntf = 2, ntb = 2,
> cut = 10.0, nsnb = 20,
> nstlim = 50000, nscm = 2500, iwrap = 1,
> t = 0.0, dt = 0.002,
> temp0 = 300.0, tempi = 200.0, tautp=0.5,
> ntt = 1,
> ntp =1 , taup = 1.0,
> ntc = 2, tol = 0.00001,
> ibelly=0, ntr=1,
> restraintmask=':1-873' , restraint_wt=10.0,
> &end
> /
>
> Step-4:heat NPT 0.5 ns
> Heating System
> &cntrl
> imin=0, nmropt=1,
> ntx=1, irest=0,
> ntpr=500, ntwr=500, ntwx=500, iwrap=1,
> ntf=2, ntb=1, cut=10.0, nsnb=20,
> igb=0,
> ibelly=0, ntr=1,
> nstlim=250000, nscm=500, dt=0.002,
> ntt=1, temp0=300.0, tempi=0.0, tautp=0.5
> ntc=2,restraintmask=':1-873',
> restraint_wt=100,
> &end
>
> &wt type='REST', istep1=0, istep2=0, value1=1.0, value2=1.0, &end
> &wt type='TEMP0', istep1=0, istep2=250000, value1=0.0, value2=300, &end
> &wt type='END' &end
> /
>
> Step-5:Density Equilibration
> &cntrl
> imin=0, nstlim=250000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=2, ntp=1, taup=1.0,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=10000, ntwx=10000, ntwr=10000,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1, restraintmask=':1-873', restraint_wt=20.0,
> ioutfm=1, barostat=2,
> /
>
> Step-6:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1,
> restraintmask="(:1-838 & @CA,C,N,O) | (:839) | (:840 &
> .P2,O9,O10,O12,O4,O2,C5,C3,C1) | (:841-873 &
> .P,OP1,OP2,O3',O5',C3',C4',C5')",
> restraint_wt=10.0,
> ioutfm=1,
> /
>
> Step-7:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1,
> restraintmask="(:1-838 & @CA,C,N,O) | (:839) | (:840 &
> .P2,O9,O10,O12,O4,O2,C5,C3,C1) | (:841-873 &
> .P,OP1,OP2,O3',O5',C3',C4',C5')",
> restraint_wt=5.0,
> ioutfm=1,
> /
>
> Step-8:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1,
> restraintmask="(:1-838 & .CA,C,N,O) | (:839) | (:840 &
> .P2,O9,O10,O12,O4,O2,C5,C3,C1) | (:841-873 &
> .P,OP1,OP2,O3',O5',C3',C4',C5')",
> restraint_wt=1.0,
> ioutfm=1,
> /
>
> Step-9:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=1,
> restraintmask="(:1-838 & .CA,C,N,O) | (:839) | (:840 &
> .P2,O9,O10,O12,O4,O2,C5,C3,C1) | (:841-873 &
> .P,OP1,OP2,O3',O5',C3',C4',C5')",
> restraint_wt=0.25,
> ioutfm=1,
> /
>
> Step-10:MD1 simulation backbone restrained
> &cntrl
> imin=0, nstlim=100000, dt=0.002,
> irest=1, ntx=5,
> ntc=2, ntf=2, ntb=1,
> cut=8.0, iwrap=1, ig=-1,
> ntpr=500, ntwx=500, ntwr=500,
> ntt=3, gamma_ln=5.0, temp0=300.0,
> ntr=0,
> ioutfm=1,
> /
>
> Step-11:good energy conservation, 2fs.
> &cntrl
> ntx=5, irest=1,
> ntc=2, ntf=2, tol=0.000001,
> nstlim=250000000,
> ntpr=1000, ntwx=1000,
> ntwr=10000,
> dt=0.002, cut=8.0,
> ntt=0, ntb=1, ntp=0, ntr=0,
> ioutfm=1,
> /
> &ewald
> dsum_tol=0.000001,
> /
> _______________________________________________
> AMBER mailing list
> AMBER.ambermd.org
> http://lists.ambermd.org/mailman/listinfo/amber
>
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
Received on Wed May 14 2025 - 05:00:03 PDT
