Michiel,
The standard nucleic acid residues in AMBER were not
parameterized to include a 5'-phosphate. You would need
to create a new residue for this (mol2 and frcmod files for
charges and parameter info respectively).
You could fudge this by hand (probably a bad idea) or you
could use the established procedure often done with RED:
http://q4md-forcefieldtools.org/REDS/
Most RNA simulations in the literature do not include the
5'-phosphate. Are you sure it's vital for your results?
--Niel
________________________________________
From: Michiel de Hoon [mdehoon.gsc.riken.jp]
Sent: Friday, August 31, 2012 8:30 AM
To: amber.ambermd.org
Subject: [AMBER] newbie question: simulating miRNA
Dear all,
I am trying to simulate the dynamics of a mature microRNA of 22
nucleotides, and I am running into a problem creating the initial structure.
The sequence I want to simulate is "uagcuuaucagacugauguuga".
To create a PDB file with this sequence, I use this .nab file:
molecule m;
m = fd_helix("arna", "auagcuuaucagacugauguuga", "rna");
putpdb( "mirna.pdb", m, "-wwpdb");
I run nab on it, and I run the resulting executable. This gives me the
mirna.pdb file.
Since this PDB file contains a double helix of RNA and I am interested
in only a single strand, I edit the PDB file to remove the second strand.
The sequence I give to fd_helix has one additional nucleotide "a" at the
5' side. This is because I noticed that fd_helix creates an RNA with a
5' hydroxyl group instead of a 5' phosphate group. So I added this dummy
nucleotide, I remove all its atoms except its final oxygen from the PDB
file, and associate the last oxygen with the subsequent "u" nucleotide.
My PDB file then looks as follows:
ATOM 1 OP3 U 1 7.297 -6.145 5.250 1.00
0.00 O
ATOM 2 P U 1 6.882 -5.338 6.560 1.00
0.00 P
ATOM 3 OP1 U 1 7.505 -5.970 7.750 1.00
0.00 O
ATOM 4 OP2 U 1 5.404 -5.201 6.610 1.00
0.00 O
ATOM 5 O5' U 1 7.538 -3.907 6.290 1.00
0.00 O
ATOM 6 C5' U 1 8.968 -3.825 6.160 1.00
0.00 C
ATOM 7 H5' U 1 9.304 -4.443 5.327 1.00
0.00 H
ATOM 8 H5'' U 1 9.430 -4.176 7.083 1.00
0.00 H
ATOM 9 C4' U 1 9.384 -2.375 5.910 1.00
0.00 C
ATOM 10 H4' U 1 10.470 -2.299 5.860 1.00
0.00 H
...
ATOM 698 C2' A 22 7.329 -4.907 64.990 1.00
0.00 C
ATOM 699 H2' A 22 7.159 -4.004 65.576 1.00
0.00 H
ATOM 700 O2' A 22 8.718 -5.197 64.960 1.00
0.00 O
ATOM 701 HO2' A 22 9.154 -4.443 64.556 1.00
0.00 H
ATOM 702 O3' A 22 7.233 -6.221 67.070 1.00
0.00 O
ATOM 703 HO3' A 22 7.285 -5.486 67.686 1.00
0.00 H
TER
Then I start xleap:
xleap -s -f $AMBERHOME/dat/leap/cmd/leaprc.ff99SB
I don't know if ff99SB is the appropriate force field to use to simulate
RNA, but that is what I used.
Inside xleap I then do:
> rna1 = loadpdb "mirna.pdb"
Loading PDB file: ./mirna.pdb
Created a new atom named: OP3 within residue: .R<RU5 1>
Created a new atom named: P within residue: .R<RU5 1>
Created a new atom named: OP1 within residue: .R<RU5 1>
Created a new atom named: OP2 within residue: .R<RU5 1>
total atoms in file: 703
Leap added 1 missing atom according to residue templates:
1 H / lone pairs
The file contained 4 atoms not in residue templates
Next I add sodium ions for neutralization:
> addions rna1 Na+ 0
21 Na+ ions required to neutralize
Adding 21 counter ions to "rna1" using 1A grid
...
So this is my problem: Only 21 counter ions are added, while the
microRNA contains 22 nucleotides. The output from loadpdb suggests that
the 5' phospate group is not being recognized, which may be the reason
why xleap only adds 21 sodium ions.
What is then the right way to create an RNA sequence with a phosphate on
its 5' side and a hydroxyl group on its 3' side?
Many thanks in advance,
-Michiel
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
_______________________________________________
AMBER mailing list
AMBER.ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber
Received on Fri Aug 31 2012 - 09:00:04 PDT
